.
lacritica.eu

AGENTE PROVOCADOR

Por qué nuestro código genético quizá sea extraterrestre pero las Pirámides no

Por qué nuestro código genético quizá sea extraterrestre pero las Pirámides no
Ampliar

agente.provocador.000@gmail.com

Add to Flipboard Magazine.
Las Pirámides de Egipto se quedan pequeñas al lado de la enormidad de tonterías que se han escrito sobre si su construcción la hicieron los marcianos y son naves espaciales o algo así. Pero lo curioso es que el ADN que llevamos en todas y cada una de nuestras células sí que tiene ciertas posibilidades de tener un origen extraterrestre.

Vamos a explicarnos, y nos vamos a apoyar para ello en las Pirámides de Egipto.

Leí (no recuerdo dónde) que la diferencia entre una verdad ‘como un templo’ y otra ‘como una pirámide’, es que las segundas pinchan. Ya veremos, porque por aquí hay de todo.

La mayoría de la gente, cuando se habla de las Pirámides de Egipto da por supuesto que son tres, muy fotogénicas por cierto, y que están en las afueras de El Cairo. Vale, sí y no. Para empezar, en la llanura de Giza, además de un gran desguace de coches y un campo de golf hay una decena de pirámides de distintos tamaños, pero las tres grandes son tan enormes que nadie se fija en las otras siete. Un detalle sobre su tamaño: con las piedras de la más grande se podría hacer una buena muralla de un par de metros de alto que daría la vuelta completa a toda España (bueno, quizá haya que prescindir de alguna esquina para que cierre bien); el cálculo lo hizo el equipo de Napoleón, que no era mal científico, y es fácil demostrar su completa exactitud.

Además, no he escrito las Pirámides de Giza, sino de Egipto, y en el resto del bajo Egipto hay unas cincuenta pirámides en distinto grado de conservación (algunas son ahora poco más que un montón de guijarros y arena), y ese es un detalle relevante para lo que hablaremos a continuación sobre el ADN (quizá) extraterrestre.

Porque gracias a ello tenemos mucha información sobre las pirámides. Su evolución técnica, por ejemplo: la primera es escalonada; la segunda se les hundió a la mitad de su construcción y está en ruinas; a la tercera le tuvieron que variar el ángulo de las paredes cuando estaba a mediohacer porque también corría riesgos estructurales en caso no hacer esa corrección y es quizá la más impresionante vista de cerca; la cuarta, espectacular en su soledad en medio del desierto es, en mi opinión, la más bonita de todas, la Pirámide Roja la llaman. A continuación construyeron las famosas de Giza, la más grande de las cuales se tardó veintitantos años en levantar, y se conservan los partes de trabajo que lo documentan. Luego empezaron a abaratar el proceso y las hacían de adobe y poco más, pero recubiertas de piedra bien tallada, por lo que el aspecto exterior era igual que el de ‘las buenas’, aunque con el (mucho) tiempo, y la ayuda de los que quitaron las piedras exteriores para construir mezquitas en El Cairo la mayoría de esas pirámides tardías se han convertido en colinas redondeadas.

¿Qué tiene esto que ver con el ADN? Tranquilidad, que ya llegamos.

Resumiendo lo de las pirámides: aunque siempre habrá quien diga que es Un Misterio, sabemos cuándo, quién y, más o menos, cómo las construyeron (conocían varias técnicas para subir las piedras, pero no sabemos cuál de ellas en concreto utilizaron, quizá varias formas a la vez), están a la vista ejemplos de su evolución, diseños fallidos, etc.

Y luego están las pirámides de los mayas, en Centroamérica, con un origen por completo independiente, incluso (un ‘quizá’ muy ‘quizá’ aquí) las pirámides de Bosnia (los interesados que busquen en el navegador por ‘bosnian pyramids’ y puede que concluyan que existen, sí, pero que no son más que un chanchullo).

Por el contrario, de nuestro código genético (que está por todas partes y desde hace mucho), no sabemos ni el Cuándo, ni el Cómo (lo del Quién es para nota), no conocemos diseños alternativos, anteriores ni posteriores, ni diseños fallidos, ni versiones simplificadas. Todos los seres vivos de este planeta están basados en el mismo ADN, con los mismos mecanismos de reproducción y siguiendo los mismos códigos de interpretación, ya hablemos de ballenas o mosquitos, de la reina Cleopatra o de una Sequoia Gigante de California, de una bacteria del final de nuestro estómago o del presidente de ese banco tan importante. El ADN, simplemente aparece sobre La Tierra en algún momento de hace unos 3400 millones de años… y hasta hoy, sin alternativas, cambios, mejoras ni desvíos, con el poco significativo caso de algunas células basadas en el ARN, que no deja de ser una parte del mismo ADN de siempre. Muy raro ¿no?

Si la formación de La Vida fuese un fenómeno más o menos ‘fácil’ de producir en la Naturaleza, podríamos esperar que, ya que se dio en los primeros mil millones de años de La Tierra, cuando era un puchero en pleno alboroto de cambios, en una época en la que los escombros de la formación del Sistema Solar todavía estaban un poco por todas partes y golpeaban los planetas con mucha mayor frecuencia que ahora dejando cráteres enormes, y sin nada para comer, ¿por qué no se han vuelto a producir brotes de Vida nuevos en los más de tres mil millones de años siguientes? Es que ni siquiera uno.

Voy a resaltar un detalle sutil pero tremendamente significativo, aunque puede necesitarse varios párrafos para sacar adelante la idea: el Código Genético. Veamos.

El ADN de quien esto escribe (y, espero, también de quien lo lee salvo que sea un marciano) está formado por unos tres mil millones de ‘bases’, que son unos nucleótidos que se suelen abreviar como A, G, T y C (adenina, guanina, timina y citosina). Por lo tanto, el ADN se podría describir como dos hebras de aminoácidos que se pueden documentar como ‘ATCGATCGCGTATGGCTAACTAGCGGCCTTA…’ y así hasta 3000000000 de letras de estas (más o menos).

Pero el ADN no es sólo una molécula así de compleja porque sí, sino que además hace un trabajo: construye un ser vivo, lo reproduce y lo mata cuando más le conviene a esa molécula. Y eso lo hace a base de fabricar Proteínas a lo largo de toda la vida útil del ser vivo. Unas proteínas desencadenan que nos salgan los dientes de leche, hace otras unos años después para que se nos caigan y, las siguientes, las hace para que salgan los definitivos que, si los cuidamos, nos duran el resto de nuestra vida. Otras proteínas hacen que nos crezca (o no) el pelo, los pechos (sobre todo a algunas), o tengamos la piel de un color u otro. Otras intervienen en la excitación sexual y provocan la reproducción…

Pues visto así, si alguien está imaginándose el ADN-fabricante-de-Proteínas como el puñetero director de orquesta que nos hace ser como somos, estará acertando en plena diana: es exactamente así. Se podría decir que La Vida es nada más que la manera que tiene en ADN de viajar y replicarse.

La secuenciación por la que el ADN consigue todo esto en el orden correcto está todavía en estudio, pero en líneas generales el proceso se conoce con bastante detalle y el caso es que lo hace con relativo éxito. En mi caso puedo quejarme de algunos fallos, como tener una pierna algún centímetro más corta que la otra o que nací con un riñón de menos, y puedo echarle la culpa al destino, a mis padres… o al ADN; que todo viene a ser lo mismo.

Y ¿cómo ‘fabrica’ el ADN los infinitos aminoácidos a lo largo de la vida? Pues lo hace de una manera complicada, pues se pliega cada vez de una manera diferente, y, con algún paso intermedio que no viene al caso para esta discusión, en la parte de la hebra que queda en el exterior se ‘pegan’ otras moléculas especializadas, que son el meollo de lo que trato de contar en estos párrafos, por lo que les dedico uno para ellas:

Son moléculas que, cada una, en uno de sus extremos tiene afinidad por una combinación de tres letras (vale, aminoácidos), una muy concreta de las que forman el ADN y, en el otro extremo, cuando están atracadas en el muelle correcto, producen un trozo concreto de la proteína final. Por lo tanto, unas se pegan en una secuencia GAT, y producen la pieza 11, por ejemplo; al lado, el ADN ‘decía’ TTC y allí se pega la molécula correspondiente, que en su otro extremo produce la pieza 6; la siguiente de la cadena es, por ejemplo, otra vez un trio GAT, y la proteína en construcción recibe allí otra pieza tipo 11, la siguiente puede ser un trío CTC, y la pieza que se empalma a continuación es de tipo 8, por ejemplo y, de ese modo ese día esa célula estará soltando a nuestro torrente sanguíneo una proteína de fórmula ’11-6-11-8…’ ¿Me han seguido hasta aquí? Advierto que ya estamos llegando. Y, por cierto, por descubrir alguno de estos detalles fue por lo que le dieron a Don Severo Ochoa su Premio Nobel.

Hemos entendido, espero, que hay moléculas especializadas que convierten GAT en 11, TTC en 6, CTC en 8, etc. Parece obvio en este punto que todo funcionaría exactamente igual si ese juego de ‘llaves’ funcionase de cualquier otra forma, por ejemplo que la molécula que encaja en la secuencia GAT produjese la pieza 6 de la proteína y la de TTC produjese la pieza 11, con tal de que para producir la proteína ’6-11’ el ADN dijera TTCGAT en los seres del primer modelo, y GATTTC en los de las segunda especie. Todo funcionaría exactamente igual, aunque serían especies claramente diferentes. Precisamente a eso es a lo que se le llama ‘El Código Genético’, el código de traducción entre el ADN y las proteínas, el diccionario que lee el ADN y lo convierte en proteínas y no hay ningún inconveniente técnico para que hubiese tantos ‘idiomas’ como especies.

Pero, y ahí llegamos al meollo del meollo, el caso es que todos los seres vivos conocidos funcionan con el mismo Código Genético, con el mismo juego de llaves, todos hablan el mismo idioma.

Si La Vida basada en el ADN hubiera surgido varias veces, la probabilidad de que desarrollasen el mismo código de traducción es, como mínimo, muy escasa. La posibilidad de que todos coincidan es extremadamente remota. Por ello, en el ADN está la demostración de que toda La Vida de La Tierra tiene un único origen; es como si, de la nada, hubiese aparecido una bacteria hace más de 3000000000 de años y todo lo demás derivase de ese único ejemplar. Los terrícolas de cualquier número de patas parece por lo tanto que tenemos un antepasado en común.

Por eso se puede estar investigando la genética del cáncer humano en la mosca de la fruta, porque el 75% de nuestras enfermedades de origen genético funcionan casi exactamente igual en la mosca.

Desde los mejillones hasta el cerdo ibérico, pasando por la encina y las amapolas, se podría decir que todos somos parientes relativamente próximos. Y lo que podríamos encontrar en otros planetas de otras estrellas tenemos la duda de si serían parientes lejanos o realmente no tendríamos nada que ver con ellos.

Si encontramos por ahí fuera seres vivos que, no sólo se basan en el ADN, sino que lo traducen con el mismo Código Genético, nadie nos podría convencer que ambas formas de vida comparten antepasados comunes. Pero eso es sacar los pies del tiesto, porque no hemos encontrado nada en la Luna ni en Marte, pero resulta tentador explorar el Espacio para ver encontramos alguien o algo que resulta ser de la familia.

De todas maneras hay quien echa balones fuera, muy fuera, incluso fuera de cualquier planeta basándose en que el espacio exterior es el ambiente ideal para producir los aminoácidos que forman el ADN, gracias al bombardeo de rayos cósmicos sobre átomos variados y mezclados en el entorno de muy baja gravedad de un cometa, por ejemplo. De hecho el meteorito Murchison tenía 15 aminoácidos extraterrestres, alguno de los cuales no existe aquí abajo, y por eso se emocionan tanto los astrofísicos con el estudio de cometas y asteroides remotos y pequeños: porque ahí puede estar la explicación de muchas cosas.

Ello explicaría, ojalá, por qué no encontramos aquí los toscos diseños previos de La Vida y sí de las pirámides, por qué toda La Vida utiliza los mismos planos, pero las pirámides no. Además de que no sabemos cómo empezó a funcionar aquella bacteria antepasada nuestra. Y no hay otras explicaciones alternativas convincentes.

Se ha hecho la comparación de que suponer que el ADN y su mecanismo de reproducción se produce como por casualidad agitando vigorosamente una sopa de aminoácidos y nucleótidos es como si removiendo la chatarra de un desguace de coches se nos montase un Boeing-747 y quedase listo para volar, incluido el combustible y los pilotos. No sé si estoy de acuerdo en el ejemplo, pero lo saco a colación porque lo sospechoso no sería (tan sólo) el hecho de encontrarnos un avión a reacción utilizable, sino la cara que se nos quedaría si llegamos a una isla perdida y encontramos que tienen fuerzas aéreas a reacción, pero no encontramos aviones de hélice, ni coches, ni barcos de vela: nos dicen que ese es su primer diseño y… ¿nos lo creeríamos?

Se podría decir que trasladar el problema a otro planeta, cometa o asteroide no cambia la pregunta principal de cómo empezó todo, que tan sólo se lleva la pregunta a otro sitio, pero los biólogos, de la mano de los astrofísicos, tienen la esperanza de que quizá allí sí que encontrásemos los diseños alternativos, erróneos, mejorados o desechados que nos ayudasen a entender la técnica de creación de Vida, los planos de la oficina de diseño. Porque el problema es que ahora sólo tenemos ante nosotros (dentro de nosotros en realidad) un producto muy desarrollado, pero que terminó su evolución básica hace 3000000000 de años, justo el día que empezó, y no sabemos si es lo mejor que se podía hacer o resulta que era un desarrollo casi fallido que se escapó del nido y cayó por aquí por error.

Evidentemente, también se puede pensar que fue un Dios todopoderoso que decidió empezar las cosas de esa enrevesada manera. Al respecto Alfonso X El Sabio decía, por lo visto, que si Dios le hubiese consultado, él le hubiera recomendado algo mucho más sencillo (es fácil opinar que pocos de sus sucesores han estado a su altura, intelectualmente hablando).

Y si dejamos de mirar al Pasado, y nos preocupamos del Futuro a la luz de estas ideas, ¿qué podemos plantearnos? Voy a intentar un par de pinceladas por si el lector no está muy cansado.

Con abundantes excepciones, la mayoría muy discretas, la evolución de la especie nos ha llevado a ser fieles a nuestra pareja, a nuestros hijos: les protegemos porque llevan nuestros genes, aunque lo digamos con otras palabras. También, siempre que no entre en conflicto con lo anterior, somos fieles a nuestros paisanos, que comparten bastantes genes con nosotros. Siguiendo ese hilo de razonamiento, deberíamos descubrir al final de la madeja una cierta fidelidad a todo tipo de vida y, efectivamente, sin llegar necesariamente a extremos de vegetarianos radicales (que, por alguna razón, a las plantas no las respetan tanto como a los animales), nos repugna exterminar seres vivos si no entra en conflicto con los niveles superiores: lo aceptamos si es para defender a nuestros paisanos, a nuestra familia, para alimentarnos…

Y lo mismo que intentamos proteger y extender nuestra estirpe o la influencia de nuestro país, en algún momento nos podríamos plantear llevar La Vida más allá de sus fronteras actuales y extender un bonito manto de vegetación sobre los planetas susceptibles de ser poblados. Así, ya que no es fácil por el momento que viajemos nosotros o nuestros hijos, podríamos enviar Vida a Marte, quizá Venus, o a los océanos subterráneos de Europa (me refiero al satélite de Júpiter con ese nombre, que nuestro viejo continente ya tiene vida de sobra, aunque se pueda discutir si es o no vida inteligente).

Es muy posible que si enviamos cápsulas de bacterias adaptadas a esos terrenos, sin más que esperar unos cuantos millones de años nos encontremos por allí bichos de muchas patas, que compartirían con nosotros el mismo Código Genético.

Y, para terminar en punta: ¿Acaso fue de esa forma como llegamos aquí?

Félix Ballesteros Rivas

22/02/2016

agente.provocador.000@gmail.com

¿Te ha parecido interesante esta noticia?    Si (0)    No(0)
Compartir en Google Bookmarks Compartir en Meneame enviar a reddit compartir en Tuenti Compartir en Yahoo


Normas de uso

Esta es la opinión de los internautas, no de LA CRÍTICA

No está permitido verter comentarios contrarios a la ley o injuriantes.

La dirección de email solicitada en ningún caso será utilizada con fines comerciales.

Tu dirección de email no será publicada.

Nos reservamos el derecho a eliminar los comentarios que consideremos fuera de tema.